I don't believe it is possible yet on this site to make a poll, but I was curious what the percentage of Ron Paul supporters were Evolutionists or creationists. Obviously Huckabee's campaign was highly creationist and McCain's would probably be more evolutionist. But what about Ron Paul's?
This is not a debate, do not post arguments, just simply post creationist or evolutionist, whichever you believe. If you believe in intelligent design you need to write creationist because they are the same thing.
If you do not feel comfortable posting this, then don't. Simple as that, no one need be offended. This is just a small unscientific survey for the sole purpose of satisfying my curiosity.
I am an Evolutionist.
Subscribe to this thread- Flag as offensive
- Login or register to post comments
- 6237 reads
****
My own understanding of the Evolutionist v. Creationist argument can be summed up in a short anecdote:
You're walking down the beach on a beautiful Saturday morning. You have a metal detector and get a hit. After an hour of digging, you are staring at a beautiful new Ferrari, candy apple red with GPS, XM Radio, TV and installed minibar.
Do you a) Wonder why the hell someone would make this wonderful device, everything working perfectly, and then leave it buried in five feet of sand to collect rust, ruin its engine and all that? Or do you b) Wonder to yourself, "Wow, look how years of wind, rain, salt, water and sand have come together to create this amazing car."?
The mathematical probability of Evolution being a SOLE means to creation is a "number" indistinguishable from zero. The number I saw years ago was 1/29million-billion just for a single cell to have evolved into what it is. The theory of the Big Bang once again is mathematically ludicrous as a SOLE means to creation.
People have this idea in their heads that Christians believe that the universe is 5,000 years old, clutch our Bibles and trust that God will provide for everything. Unfortunately there are a great many that still do, same way that there are a great many who believe humans used to be amoeba. But the Bible is an extremely unique book, and Jesus was an extremely unique individual. Historically the Bible is a marvel. The reason that science will never disprove "religion" is that the Bible is true. The reason the Bible will never disprove science (other than that religion has rarely attempted to do so) is that Science is factually evident. I don't believe debate on this issue is pointless, as one writer put it, because it's all based on faith. I think it's necessary, but "pointless" only in that the two (science and theism) aren't mutually exclusive.
http://www.dyeager.org/blog/2008/04/probability-of-evolution.html
That's the Teleological Argument. Refuted by Hume DECADES before Darwin.
The reason why we consider those things to be designed is twofold: 1) We know (or can easily find out) how humans designed and built them. 2) We know of no way they could have formed naturally. NEITHER of those is true in the case of life. Unless you can refute anything other than a strawman, AND can take us to the designer's life factory, or show us his blueprints, this argument is COMPLETELY specious.
"The mathematical probability of Evolution being a SOLE means to creation is a "number" indistinguishable from zero. The number I saw years ago was 1/29million-billion just for a single cell to have evolved into what it is."
Cited by creationists who never seem to want to show their work.
This is a false dichotomy. The options are NOT limited to creation or chance. Evolution is NOT chance.
If I let go of an object, the chances of it going in any one direction (based on two 360-degree coordinates) is 1 in 129,600. Yet, it ALWAYS moves in a direction consistent with straight down. This isn't chance, nor is it the Hand of God pushing it in that direction. It's natural law.
"The reason that science will never disprove "religion" is that the Bible is true."
Then how come it says so many things that are demonstrably wrong and even self-contradictory?
Predicted.
Anybody who still thinks evolution can be refuted or rejected on probability clearly doesn't understand
1. Statistics
2. Natural selection
3. Evolution
4. Scientific method.
Evolution scientists are FAR FROM leaving only two probabilities, they are open to ALL CHALLENGES that pass scientific tests (and when speaking of Creationism, it's just an example of how poorly it fails science)
"because it's all based on faith. " is not true, if you know what you're talking about.
"The government should be afraid of its people, not the other way around".
I came from humans. Biblical Creationist.
"I came from humans. Biblical Creationist."
No one says otherwise. Strawman.
But really to me it's a non issue. I think Jefferson said it best when he said that "it does me no injury for my neighbour to say there are twenty gods, or no god. It neither picks my pocket nor breaks my leg". His faith or lack thereof is not why I support Ron Paul either, i support him because he has been the most sincere when it comes to defending the Constitution, and from what i've seen has not let his own personal beliefs in a deity affect that in one way or the other.
"What luck for Rulers that Men do not think" - Hitler
I agree, except when the creationists start going around misrepresenting science (like Kent Hovind, Michael Behe, Ken Ham, and so many others do). Our government schools are screwing up science education badly enough as it is without these guys coming along and making the problem worse...
good point. the lunatics and liers have to confronted, not dismissed. to think that a delusion held by people does no harm to anyone is naive. given the historical record of delusional mobs it is clear to see that action must be taken to repel and discredit the lies they spread.
I ACCEPT the Modern Theory of Evolution as sound science: it is not a belief, any more than blueberry cheesecake is a shoe style.
-SG
"Beer is proof that God loves us and wants us to be happy."
The Grackle's Nest I
Evolution FTW!
What people need to understand, is that you cannot empirically prove creation or evolution (and for those of you saying you BELIEVE in evolution, thank you for being honest).
Now from doing A LOT of research on this topic over the past 5 years, I've found much more scientific and logical sense in Creation, however, I am not going to talk about that.
What we should be discussing, is that if neither is provable empirically (and yes, that would make evolution a religious idea by definition, and that you have all the free right in this country to believe in)... why are we teaching evolution as fact in our public school systems? Shouldn't I have the right NOT to pay for those textbooks that teach against what I believe?
I'm so glad there are so many people on this site that are against the Dept of Education (bring it down, w00t!)... but it goes deeper. Go to any communist country in the world, and check out their schools... they will be teaching what? Communism? No, my friends... they teach evolution. It is REQUIRED for communism to survive. The idea that rights do not come from God, they come from the state.
Whether or not evolutions agree or disagree with that is not the point. The purpose of this is the principle of what evolution teaches... and any teaching in general will imply morals. Evolution does imply morals, and children will learn these morals and then carry them out. The shootings in Columbine... the media made a lot of effort to cover up the t-shirts the kids were wearing that said "Darwinism" and "Natural Selection". They performed their executions of these children on Hitler's birthday... on purpose.
I have not read this entire forum section, I honestly don't have the patience to go through it all, haha! :) Many times I see people posting things that, though they are well intentioned, they've not studied thoroughly enough, but hey, we all have our expertise right? (I'm learning about hemp right now and I didn't know it existed until yesterday, and it's AWESOME!)
The issue that honestly should be raised... is why are we endorsing our now state-funded religion: Evolution. Why is it the bias? I quote Hitler: "Let me control the textbooks and I will control the state." Hitler: "Tell a lie loud enough and long enough, and the people will believe it." Hitler: "The people are more likely to believe a big lie, than a small one." It was the belief in Evolution that drove most of Hitler's actions.
As we in the freedom movement have seen... there are many hoaxes at work. Unfortunately, it seems every person I talk to can only see a few of them, but not all. I will be starting a youtube channel soon to discuss not only the issues of our cause for freedom, but also the massive wool of evolution that has been pulled over the eyes of the American people. I hope I'll be able to post that somewhere here after I get some recording done.
There are some great books you all can read if you want a good understanding to this "debate"... Darwin's Black Box, Michael Behe (explains the biochemical challenge to evolution; I heard Micheal Shermer in a debate say that he had no evolutionary explanation to this) -- Darwin on Trial, Phillip Johnson (puts Darwin's concepts in a court of law; science proves law)
The burden of proof, however, belongs solely to the evolutionist. Creationists are not asking for taxpayers dollars to teach creation, but evolutions are. Since our tax dollars are paying for it to survive and be taught, we need the empirical evidence to support it. If they cannot produce it (and I've been looking for empirical evidence for evolution for 5 years now, looking to the top minds in evolutionary sciences to provide it, and have seen nothing empirical), then we need to abolish it from our classrooms, and stop forcing the people to pay for it.
I would love to go through all the examples and I ABSOLUTELY LOVE taking questions and challenges, but you can contact me if you want more information. I'll be putting up as much as I can on the youtube channel. I hope this will shift the discussion a bit, not to argue between the two, but to argue the larger issues of principle and why evolution is in our public school system when no other religion is allowed. There is a bigger plan for the cause of evolution in our schools, formed by the neo-cons, than some of you may realize.
-Christopher Johnson, Columbus OH
We should teach that the Holocaust never happened, and teach gravity doesn't work, because teaching this will teach children that Holocaust was a right thing, and knowing gravity will allow children to learn that lynching and throwing people off airplanes is right.
Evolution is a fact, but it's a DESCRIPTION, not a PRESCRIPTION.
"The government should be afraid of its people, not the other way around".
Of those who would help us destroy one form of opression only to replace it with another.
There's a fine Irish pub in Columbus Chris, if I were in your town I would gladly meet you there to pick apart the carcass of 'Intellegent Design' and explain to you the function of logic and scientific method.
But seriously, you're going to cite Columbine as support for anti-evoltion propaganda (favoring christian dogma, I'm certain). You guys can be such fish-in-barrels! Lets go atrocity for atrocity, shall we!
Columbine: Salem Witch trials, Spanish Inquisition, Crusades, Crusades, Crusades, Pedophile priests, pre-paying for sins, most of the book of Joshua, 'Jesus Camp', Missionaries with smallpox infected blankets, Cortez, Coranado . . .
Yeah, kids studying evolution naturally want to murder classmates; that's going to sell your arguement. Absurdity.
Orville Wyatt is hiding at rejectsociety.com
> and I've been looking for empirical evidence for evolution for 5 years now, looking to the top minds in evolutionary sciences to provide it, and have seen nothing empirical
< really? what minds have you been looking to? you should try picking up a high school level science book, instead of looking to minds for 5 years. a dangerous man you are. very dishonest and intentionally misinformed.
Evolution can and has been empirically proven with overwhelming evidence. How else would you explain ERVs, the Twin Nested Hierarchies, biogeography, chromosomal fusion, documented speciation, replicated speciation, THOUSANDS of transitional fossils, nylonaise, atavisms, homologous structures, vestigial organs, genome synteny, gene order, wobble position sequence, intron sequence, pseudogene sequence, transposons, the astounding success of evolutionary computer algorithms, and, oh yeah, hundreds of thousands of peer-reviewed scientific papers supporting it?
Next You're going to tell us that science can explain how planes fly! Give me a break.
Doesn't this get ridiculous? The one TRILLIONnth meal containing GMOs was consumed last year and those who would love a theocracy still tell us that the fundamental science that lead to the greatest andvancements in agriculture, medicine, and ecology (EVER) is false.
The IDer's arguement always reminds me of Orwell's 'principles of NewSpeak' appendix at the end of 1984.
Orville Wyatt is hiding at rejectsociety.com
(oh, yeah, all demeaning satire herein is aimed at IDers. I understand there are some logical, rational creationists of various sorts. Never met a Hindi I din't like, for example, Namaste.)
Here's a nice bit a genomic sequence for the IDers. Find for me the exons that compose a functional heavy metal detoxification gene and explain its homology across phyla using your little theory, if you don't mind. When you're through I have ~100,000 more examples and 2,000,000 more species (almost half are beetles!) to cover.
What's that?! It's all just deceptive etymology with no backing in scientific method and can't explain s__t about the observable world?!
No way!
Really?!
AGATCCATGAAATGCAACTTGAGGATACTCATATTTCACAAGCATTTGTACAACAATTTTTTTTTTTTTT
TTTTTTTATGGTGCATTTGTACAACATTGATCTATGACTAGTATATAATAATAATAATATATCGTACATA
CATAAAAAAAGAAGACAGAACGATATATCATTAATCAACTCATTATCATCACATGATGATTCCATTTAGA
CACATTTTTTCCTCTCCATATTCCACCAACAAAACTCCAAAAAAATTTCATATTGTTCTCTCTATTATTC
ATATGATGATGGACTTTATGAAATGATGCATGCATTAGGATTTTCATCACTGAATAGTTGAGGTGGTGGA
GTACGTTCAATCACATAAAGTGGAGGATATTGATAATAATACATCATTCTCTTCATTCCTTCTTCATCAA
TATTAACCATAGCAGTAGCACCACTCTCTTCTTTCTTGGTTTCTTCTTTGCTTTCTTCACCCCCTTTTTC
TTCTTTATTCTCACCCCCTTCTTCTTTCTTTGGTTCTTCTGTTGGTTTCTCTTCTTCTTTCTTATTCTCT
TCTGGTTTAGCTTCTTCTTCTGCTGCAGGTTTTTCACCTTCTTTGCTTTCTTCTTCTTTCTTTTCTGGTT
CAGGTTCGGGTTTAGGAACTATTTTCGCTTGTTTTTTGGTTCTTCTATAGACATAATCCACTAGCTTGTT
TGCATCCATTGTTCCTGTCACAGTTACTTTCCCTGTGCTAAACTCTGTCACTGCTGTTTGAACTCCTACA
TTAATCAATAATGTTTTTACATTAATTAATGCAAATAAATATGGCATTGATTGAATACTAGTACTATTTT
GTCAAGAGCATTTGATTCATGGTCAAATGGACATGACCATGGTTTTAAACTATGGTCCGAAATGCAATAT
AAAGGTGTCTGTAATAACATCGCAACCACAATTCTGACCATAATGGTCATATTTTCTCATAATATAACGG
TTTGTGGCGTATCCACAACTGCGGCCACAGTTCAAAACCTTTCTATATTATTCAGGTGCTCTTTTGTCTA
CTTCACATATGTATATACATAATTTAGATTGCCTTGTGGGGCATGATTTCCACGCATTTGAGTGGTTAAC
AAGATTTTGGAGTTATTGAATCACGATTAGACAATTCCGATTTCGACCCAATTTAAAAGCATGAATGTGT
GGAAATAGTAATCGCAGACAATCTAAATTCGTATATGCATGAAGAATTAAATATTTATTTAAAGTAAAAA
ACTAATCCAAATTGAACTTAAGAACACAAATTGATTTATGAGGAGTCATATATACAAGGGTATTATTCAT
GTATAATGAGACACCTTGAATAAAAAGAAAGTGTATAAAGAAAATTTGTTAGGTGAATGACATGGATGAT
TCATAAAAATATGTTTCCTTTTCAATTGAATTTGTGAAAGTGTTTAAAGTTGTTTAATGCTTAATCAGTG
TTTGTTGCCAAAATTAGATTATGACAACCTTTTCCCTCCCCTTACTATTTCTCTTACTTTTTGAGGGACA
ATCTCATGCAGAGAACATGGACCATGGGGCCCACATTACACAATCACCAACCTATTTGTTCAGAAGAATG
CCACAATAAGAGGGTCTACCATCAATTAATGCTGACTTGGCAATATGATGATACAGAACATGAAAAGATG
GACATGCCCAAATTCAGGATTGATGGTTCATCCTTTTATTGGATCCCTTTGTAATATTTTATTACTAATT
TCCTTTTCTTTTTTCATGGAAGTTAATTTGTCACAATCATAAAAACTTCAATTGACACAGAAGAATTTAA
TCATTTAGAAAGTAACTGTCTATTTCTTCCCCTTTTATCTCTACATGTCCTTTTCTCAATAAGAAGTAAA
ATTATTACAACAATTATATTGAAATCAAGAAGAAACAAAGTATACCTCTCATTTGGAGTATCTTTCTCTT
GAGTTGCTCAGCACAAGCCTCACAATGCATATTCACATTAAGTTCCACTGTCTCTGGTCCACTAACCTGA
AACACCAACAAATTCCCATTGTGGATTAAGAACATGTTTAGATTGACTGATTAAAATTTATCAATCCAAT
ATAAAGTCTACTTCTGAGAGCTCATTGAAAATAATTTATGACATGTTCATAAGTTCTTTTCAACTTATTT
TCATGCGATCTTGAGGATAGTTTATATGAAAACAAGTTGACTTTATTTTTGTTATAAAAATAGTTTATAT
ATAAGTACTTATACGATAAGCACCAATACTTCTGATTAATAGTATGTGCAGTGTCCGACATTGACATATG
TAAAATTAAAGTTGATTAATTCATTTTCTCAAATTATTATCAAGAGACATGCATATTAGGGTCTTGTCCG
GTATCTATGTTGATGCTTCATAGATAAACACTTATGCTATAATTGTTTATAGGAAACCAGCTTTCCCTTT
TTTTATATGATCTTTTGAAAACAAAAGAGAAAAAAATTGTGATACCTGAGAATTGACAACTTCTGGGACA
GGTTCTCCTTCTGCTGGAGGCAATGGAGATATAACGTTTGCTCTTCTCTTTGTTTTCTTGGTAATTGTAT
TGCATATAGCTTGAGGCTCCACTATACCTTTTATGGTAACTTCATTTTTAGCCATGTCAATAACTACTCC
CTCAACTCCTGTTAAAAGATAAACATAAAAGAAAATGAGTACACATGATGCATGCATGACATTTGGTAAC
TAAAAAACTAGACAAAAATGTAACCAAACATGTACCTCTCATTTTCATTATAGATCTTTGAATCTTCTTT
GCACATCCAACACAATGCAAATCCACAAAAAGTACACATGGTTCTGGTGGTTTAGGCTCTTCCTTTTTCT
CTTCTTCTGGCTTTTCCTCTTTGCTTTCCTCCTTCTTTTCCTCTTCTTTTCCTCCTTCTGCCTTTTCTTC
TTTCTTTTCCTCTTGCTTCTCCTCAACCTTTGGTTGTTCCTATACTCAATCAAAAAGAATAAAAGTAAAC
AAATTAGTACCATGGTCCAAGAACTTATGTTGACTCACTAATGACCATTTTACAACTGTCGTTAAAGAAT
TTTGAACCATTGTTTAAATTGTTGGCAATCGCAATATAAAAGGTTTTGAGGTCTCTGCAATGGTATCACA
ACCATTAGACCACATCAGCTGCTTTTTTATGGTACAAAGGTTTGCAGCCTAACCACAATTTAAAATCATG
ATTTAAACTTTGTTCCAAATAATTATAAGATTAAAATTTTATCACTGAGCTGACACCTCGTAAACAATGT
AATGTAGACTCTATTATAACTCAATTGAATGAGAAATAATTTCAAAAAGAATTCAAAAAGAAAAATGGCT
ATAGAAAGTGATGTTACCTGTTTTGCTTCCTCGCCCATTTTGGTGTATGAAGTATCAAGTAACAATTCTG
ATTTTGGAAAATAAATGATTATGCTTAAGCATACAAAAGAGTAAGAAGAGTTATACAACTATATAGAGAA
TTAAAAGTGATATTATAAAGGAGTTTAAGATATATGGCTGGTAGTGATTAAGATTATAAAGTTAAACCAA
GTGATTCCTGATCACATGCAAAGCCACTAAC
Orville Wyatt is hiding at rejectsociety.com
We all know what a "brain" is. If you ever see what gets squished out of a head, you say "eww, that’s a brain!”
And "mind" is what the brain creates, via synaptic switching and chemicals and electrical impulses and biological stuff.
Mind is where memory and thoughts all derive, and the latest theory is that it takes much of the brain to create the personal illusion that there is a central "I" within the mind. The parts of the brain all act to create the perceptions we think of as "us", similar to a holographic image. Lots of parts assembled to make a ‘mind”.
So what then, would be "soul"?
Does soul contain mind, even though mind is generated by brain?
Or does soul exist apart from mind?
If soul exists apart from mind, does it take what mind contains (thoughts and memories) with it when it departs? If so, how can this occur without taking the brain too, when it is the brain that creates the illusion of mind to begin with, by assembling "mind" within its own assemblage of organic parts? Without brain, there is no mind, so how can "soul" run off with something that cannot exist apart from its creator, brain?
And if mind doesn't go with "soul" to the big party, why worry about "soul" and where it goes when one dies, because without mind, there is no feeling, memory etc... or ability to remember, or suffer, or nuthin' with which to either suffer for all of eternity (in one scenario) or rejoice (in the less dramatic and happier scenario)?
Why are all you religious nuts wasting your sundays in the pews when your soul's next destination is inconsequential due to its lack of "mind" caused by what we like to refer to around my house as a "dead ass brain"?
Are you really that crazy?
Read 'The Astonishing Hypothesis' by Francis Crick (co-discoverer of DNA structure)
Orville Wyatt is hiding at rejectsociety.com
That has made my brain hurt a little, but I like it.
"If God did not exist, it would be necessary to invent him." ~Voltaire
...just simply post creationist or evolutionist, whichever you believe...
We have to choose. It's one or the other. Can't be both. Versus is involved.
What a delima!
If I choose creationist, do I have to give up on Lamarck, Huxley, and Darwin?
If I choose evolutionist, do I have to give up on God and my soul?
What do I believe? Well I personally believe that this choice stuff really sucks! Just who made up these rules that you gotta choose?
No, you don't have to give up God or your soul. You may, however, have to give up certain dogmas, like the universe being 6,000 years old, or excessive narcissism, like humans being a special creation and the universe not being able to work in a way that the uninformed can't understand.
"What differences are we willing to put aside for freedom?
0I believe in creation, and I am pleased with the progress of ID science, as it further reveals what I believe to be the truth about life on our neat little planet, but I am not sure why this topic needs to be used as a wedge to drive between us here? If we cannot agree to put aside some less urgent differences in order to preserve ourselves from the abject slavery inherent in the NWO, then what point is there in having BTM in the first place? "
One of the odd things I've become aware of while swimming through this "new" movement for Constitutional restoration is the "It's a Christian country based on Christian values" nonsense.
Refitting America to its original ideals ALSO means going back to the secular notions that were built into the founding arguments.
Religion has stepped into the political arena big time and has pretty much screwed it up. Those with self-proclaimed "Christian" morals have tried to get their morality imposed on the nation by forming coalitions and voting as a religio-poitical block.
What they have inadvertantly done is grant the notion that the federal government is a proper tool for moral over-lording, and have, as a consequence, granted the federal government the false notion that it has that authority. Religion has been a major player in the usurpation of individual liberties by a central government. Just look at how many religious money-grubbing scoundrels like Falwell, Robertson, Haggart, J. Jackson, Al Sharpton et al... congregate and feed at the federal trough...
Religion outside of closed doors is antithetical to freedom. Religion is an imposed structure of thought which oftentimes demands obeisance to particular rituals and beliefs. There is no "freedom" in that, and if you want the "freedom" movement to be what it claims to be, you have to remove all religiousity from its ideals or you are simply replacing one fascistic notion with another...
I think ID is complete nonsense, but I will gladly hold Dick Cheney while you kick his a** right down the Potomac when we get the chance. Arguments are fun, at least when your opponent is making a convincing one!
I wish we could get rid of the "Jewish conspiracy" thing, personally, but freedom of speech is FREEDOM of speech.
Tom Mullen
www.tommullen.net
www.myspace.com/skepticsongs
I believe in creation, and I am pleased with the progress of ID science, as it further reveals what I believe to be the truth about life on our neat little planet, but I am not sure why this topic needs to be used as a wedge to drive between us here? If we cannot agree to put aside some less urgent differences in order to preserve ourselves from the abject slavery inherent in the NWO, then what point is there in having BTM in the first place?
This is not important on this issue only, but also when it comes to others of fundamental belief, such as goddess worship versus God worship, earth worship versus Christ worship, among many. Is it even possible for us to put down our weapons of destruction on those topics and fight together against a common enemy so that we can continue to have those debates in the future? If not, then there will be no debate in the future, and we can all acquiesce today to the freedom-destroying, mind-sucking cabal that is working against all of us and stop wasting our time and energy in this hopeless pursuit of freedom. If we are not united then we are nothing. We need to refocus on what is most important and find ways to communicate with other freedom lovers that allow discussion of that purpose, and that keep us from offending each other while we pursue it. Without such a culture and method we are merely wasting our time and spinning our wheels. We will destroy each other--much to the delight of our common enemy.
"ID science" is an oxymoron.
If I'm wrong, then explain just one thing to me: how does ID conform to the Correspondence Principle, the way every scientific theory must?
"Is it even possible for us to put down our weapons of destruction on those topics and fight together against a common enemy so that we can continue to have those debates in the future?"
Yes, but we MUST continue the debate in the interim, for two reasons: 1) we cannot let oppression retard progress while we're fighting it, and 2) the best way to preserve your rights is to keep exercising them.
I would still work with those who disagree with me on other topics to promote freedom. This just happens to be a topic of much interest to me. Sure I am arguing back and forth, but I will still defend their right to the argument. That is exercising our freedom. It's beautiful, and it is not dividing me from them, although they may divide themselves from me.
Sometimes I think argument cements relationships as much as it can divide them. I see it in my children every day, only they are arguing about much different topics. The goal, to me is to not have to put the differences aside but to acknowledge them and decide it really doesn't matter as long as we can do the thinking for ourselves. Persuasion is one thing, force is another.
"If God did not exist, it would be necessary to invent him." ~Voltaire
I agree with you that debate can be both beneficial and destructive. It can be beneficial if had among individuals who respect each other and are willing to allow others the room to think for themselves. I'm not so sure that everyone has that type of relationship in this forum. Since that is the case, then is debate on issues, where there is no hope of a possible resolution, between people who share common ground on other issues, but are currently needling each other over disputed intellectual territory, beneficial or detrimental to the cause of BTM?
In my experience dealing with people in the various church congregations I have belonged to, I can tell you that there is plenty of unity among church members when we stick to conversations relating to our common religious beliefs. When we wander into arguments about areas we do not have in common, it can lead to contention among us--if opinions on either side of the given topic are strong. What this all comes down to, then, is that it is my belief that we all ought to focus in on, and refine, what our common linkages are, and downplay--even ignore--our differences for the sake of maintaining unity among us. Since the differences in opinion among us are so deep, and are so very divisive (evolution v. creation, abortion, same-sex marriage, global warming, etc.) then it would seem that the most productive use of our time, energy and power would be in seeking to further unify those who believe in freedom through discussion about it. Everything else is leading to possible unity-stifling degeneration, through rhetorical bludgeoning, over issues that are not currently pertinent to the issues related to the taking back of our nation from the NWO globalists.
.
Since when is debate unhealthy? This isn't turning people away from their libertarian ideals at all. And ID is not a science by the way.